Strain Information | |
---|---|
DGRC Number | 114022 |
Genotype with FlyBase Link | y[1] w[*] / C(1;Y)*, y[+]; P{w[+mW.hs]=GawB}NP6657 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | y1 w* / C(1;Y)*, y+; P{w+mW.hs=GawB}NP6657 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 66D10 |
Map Viewer | |
Related Genes | CG6486 h |
Original Number | 6657 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP6657 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:66D |
Balancer | TM6UW23-1 |
Cluster id | 1830 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | clean and strong pair rule |
Larval GFP | all muscle |
Larval X-gal | distal domain (from tarsus to tibia) of the leg/antenna disc, dorsal posterior broad stripe along A/P boundary in wing/haltere discs, strong epi |
Adult GFP | epi and muscle of thorax and abd. ant wing mergin. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np01395_0711 |
Strand | Minus |
Insertion Point | 8634368 |
Chromosome Band | 3L |
Flanking Sequence | antacttggggaaaaaancccttnttngnatacttangnnaaccttcggctatcgacggg accaccttatgttatttcatcatgGTATACATTATGCGCTACCTGCTCGCTTCAGTGTGT GCGTGTGTGTGTGCGTGCTCGCGCTTGTGAGCGGTACCTAAAGTACACACCGCGTTACTC ATACGCCCCCGTGGCTCGCGGGAATGGGCATTTNTTTTTTTTTGGAAATCACACTGCGAA ACCCCCATTGGTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattg ttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatca aatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatga gctgccgagtcaatcgatacagtcaactgnctttgacctttgttactactctcttccgat gatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgag catnttnnnntnnnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |